Translation och basparning

Nukleotidkedjor har precis som peptidkedjor en början och ett slut. För nukleotidkedjor har man bestämt att 5´ska vara början och 3´slutet. Normalt skriver man 5´ till vänster och 3´ till höger.

Slutet av en viss gen på en DNA-kedja har följande bassekvens i riktningen 5´→ 3´:

5´…ACCACAAAGATGCTGATTGACAAACAT… 3´

En mRNA-kedja bildas med denna DNA-kedja som mall. Basparningen görs på ett sådant sätt att den nya kedjan får motsatt riktning mot den gamla kedjan, dvs. mRNA-kedjan får riktningen 3´ → 5´ (3´ blir alltså till vänster och 5´ till höger). Vilken bassekvens får mRNA-kedjan som motsvarar den angivna delen av DNA-kedjan?

5´…ACCACAAAGATGCTGATTGACAAACAT…3´
3´…UGGUGUUUCUACGACUAACUGUUUGUA…5´


När mRNA-kedjan fungerar som mall i proteinsyntesen avläses den i riktningen 5´→ 3´. Skriv därför basföljden för mRNA-kedjan som bildats i ovan i riktningen 5´→ 3´.

5´…AUGUUUGUCAAUCAGCAUCUUUGUGGU…3´

Vilken blir aminosyrasekvensen för den polypeptid som bildas av mRNA-kedjan i ovan? Använd tabellen för den genetiska koden.

AUG  UUU  GUC  AAU  CAG  CAU  CUU  UGU  GGU
Met    Phe    Val   Asn    Gln   His    Leu    Cys    Gly

Vad heter dessa aminosyror?
Metionin-Fenylalanin-Valin-Asparigin-Glutamin-Histidin-Leucin-Cystein-Glycin

En DNA-sekvens ser ut på följande sätt:

5´...GTGTAACCTCGTGCAGTTCATAGTT…3´

DNA-sekvensen styr bildningen av början på en peptidkedja. Hur ser den ut? Ledning: Var noga med att börja avläsningen med startkodonen, dvs AUG. Annars kan kedjan avläsas så att den blir förskjuten en eller två baspar.

3´...CACAUUGGAGCACGUCAAGUAUCAA…5´      (mRNA-bit)
5´…AACU  AUG  AAC  UGC  ACG  AGG  UUA  CAC…3´
                                        Met   Asn   Cys   Thr    Arg    Leu   His

En mutation sker så att bassekvensen i DNAkedjan blir

5´…GTGTAACTTCGTGCAGTTCATAGTT…3´

Vilken ändring i polypepkedjan medför mutationen?

5´…GTGTAACTTCGTGCAGTTCATAGTT…3´
3´...CACAUUGAAGCACGUCAAGUAUCAA…5´   
  (mRNA-bit)

5´…AACU  AUG  AAC  UGC  ACG  AAG  UUA  CAC…3´
                                        Met   Asn   Cys    Thr   Lys    Leu   His